Download pgen

Author: g | 2025-04-24

PGEN (Codejunkies version).7z download 1.3M PGEN (with updated USBD by ffgriever) v1.5.1.7z download

PGEN - Stock Quotes for PGEN Ent Holdg, NASDAQ: PGEN

Of the script demands the overhead of processing a model. To compute the pgens of many sequences, it is suggested to read the sequences in from a file and use either mode 2 or 3.It is also possible to condition the Pgen computation on V and J identity by specifying the V or J usages as a mask. However, note that these V/J masks will be applied to ALL of the sequences provided as arguments. Read Options on v_mask and j_mask for more info.Example calls:Compute the pgen of an amino acid CDR3 sequence$ olga-compute_pgen --humanTRB CASSTGQANYGYTFPgen of the amino acid sequence CASSTGQANYGYTF: 5.26507446955e-08Compute the pgen of an in-frame nucleotide sequence and the amino acid sequence it translates to.$ olga-compute_pgen --humanTRB TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTTPgen of the nucleotide sequence TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTT: 1.31873701121e-17Pgen of the amino acid sequence nt2aa(TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTT) = CASSDAQGRNRGTEAFF: 4.70599549953e-13Compute the pgen of a regular expression template of CDR3 amino acid sequences. Note, for a regular expression sequence, provided as an argument, backslashes may be needed to specify the characters {} for the sequence to be read in properly.$ olga-compute_pgen --humanTRB CASSTGX\{1,5\}QAN[YA]GYTFPgen of the regular expression sequence CASSTGX{1,5}QAN[YA]GYTF: 7.588241802e-08Compute the pgens of all three sequences.$ olga-compute_pgen --humanTRB CASSTGQANYGYTF CASSTGX\{1,5\}QAN[YA]GYTF TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTTPgen of the amino acid sequence CASSTGQANYGYTF: 5.26507446955e-08Pgen of the regular expression sequence CASSTGX{1,5}QAN[YA]GYTF: 7.588241802e-08Pgen of the nucleotide sequence TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTT: 1.31873701121e-17Pgen of the amino acid sequence nt2aa(TGTGCCAGCAGTGACGCACAGGGGCGTAATCGTGGGACTGAAGCTTTCTTT) = CASSDAQGRNRGTEAFF: 4.70599549953e-13Specify a comma delimited V or J mask to condition the pgen computation on V and/or J gene usage.$ olga-compute_pgen --humanTRB CASSTGQANYGYTF --v_mask TRBV2,TRBV14 --j_mask TRBJ1-2Pgen of the amino acid sequence CASSTGQANYGYTF: 1.39165562898e-09It is also possible to restrict the Pgen computation to specified V and/or J genes or alleles (to reflect any alignment outside of the CDR3 region) by using the options -v or -j (see example below). You can specify multiple V or J genes/alleles by using a comma as a delimiter.The only required inputs are the sequence and specifying the generative V(D)J model. Additional options can be found by using -h.Modes 2/3):These read in sequences from a file. The script has only minimal file parsing built in, so reading in sequences from a file

GitHub - ps2homebrew/pgen: PGEN is an old Sega

Requires the file to be structured with delimiter spaced values (i.e. the data is organized in columns separated by delimiter like a .tsv or .csv file). Read Options on delimiter for more info.To read in sequences, the index of column of CDR3 sequences is needed. The default is to assume that the sequences to be read in are in the first column (index 0), meaning that a text file with only a sequence on each line will be read in okay by default. Read Options on seq_in for more info.It is not recommended to read in regular expression sequences from a file. These sequences require enumerating out the amino acid sequences which correspond to them and computing pgen for each of them individually -- this can require a large time cost. Instead consider defining a custom 'amino acid' alphabet to define the symbols used in the regular expressions if possible. Furthermore, BE CAREFUL if reading in from a .csv file -- if commas are used in a regex sequence and comma is used as the delimiter of the .csv file, the sequence will not be read in properly.If nucleotide sequences are to be read in it is possible to specify if theoutput should be the nucleotide sequence Pgen and/or the translated amino acid sequence Pgen (the default is to compute and output both). See Options.It is also possible to condition the Pgen computation on V and J identity by specifying what index the column that V and J masks are stored for each line.Mode 2 does not have a specified output file and so will print the sequences and their pgens to stdout.Mode 3 does have a specified output file. By default in this mode there is a running display of the last few sequences/pgens written to the output file as well as time elapsed, current rate of computation, and estimated time remaining. This display can be disabled (see Options).As it is rare for datasets to have >> 1e4 unique sequences, parallelization is not built in to compute_pgen. However, there are options to skip N lines of the file and

pgen/readme.txt at master ps2homebrew/pgen - GitHub

COMMENT_DELIMITERcharacter or string to indicate comment or header lines to skip.generate_sequences.py (olga-generate_sequences)This program will generate a file of Monte Carlo sampling from a specified generative V(D)J model. The sequences generated will have NO ERRORS.It is required to specify the number of sequences to be generated. This is done with -n (see Options).If a file is specified to write to (using -o, see Options), the generated sequences are written to the file, otherwise they are printed to stdout.The default is to record both the nucleotide CDR3 sequence and the amino acid CDR3 sequence. This can be specified (see Options).The V/J genes used to generate each sequence can be recorded or not. Default is to record them, but this can be toggled off with --record_genes_off (see Options).Full options can be printed by: $ olga-generate_sequences -hExample calls:Print 20 generated sequences to stdout$ olga-generate_sequences --humanTRB -n 20Write 200 generated sequences to example_seqs.tsv$ olga-generate_sequences --humanTRB -o example_seqs.tsv -n 200Write 20,000 generated sequences to example_seqs.tsv$ olga-generate_sequences --humanTRB -o example_seqs.tsv -n 2e4Write only the amino acid sequences$ olga-generate_sequences --humanTRB -o example_seqs.tsv -n 200 --seq_type amino_acidSelected OptionsDescription-h, --helpshow full Options list and exit-o PATH/TO/FILEwrite CDR3 sequences to PATH/TO/FILE-n Nspecify the number of sequences to generate.--seed SEEDset seed for pseudorandom number generator. Default is to not set a seed.--seq_type SEQ_TYPEdeclare sequence type for output sequences. Choices: 'all' [default], 'ntseq', 'aaseq'--time_updates_offturn time updates off.--record_genes_offturn off recording V and J gene info.-d DELIMITERdeclare delimiter choice. Default is tab for .tsv output files, comma for .csv files, and tab for all others. Choices: 'tab', 'space', ',', ';', ':'--raw_delimiter DELIMITERdeclare delimiter choice as a raw string.Using the OLGA modules in a Python script (advanced users)In order to incorporate the core algorithm into an analysis pipeline (or to write your own script wrappers) all that is needed is to import the modules and load up a generative model. Each module defines some classes that only a few methods get called on.As the generative model structure is different between VDJ recombination and VJ recombination the algorithms to compute Pgen for the two are different. For this reason, different objects are defined for VDJ recombination models. PGEN (Codejunkies version).7z download 1.3M PGEN (with updated USBD by ffgriever) v1.5.1.7z download On this page you can download Pgen App and install on Windows PC. Pgen App is free Photography app, developed by Juli Apps. Latest version of Pgen App is 1.0, was released on (updated on ). Estimated number of the downloads is more than 5. Overall rating of Pgen App is 1,0.

Download main.exe (pgen) - SourceForge

And VJ recombination models, however the methods that get called are the same.The modules are:Module nameClassesload_model.pyGenomicDataVDJ, GenomicDataVJ, GenerativeModelVDJ, GenerativeModelVJpreprocess_generative_model_and_data.pyPreprocessedParametersVDJ, PreProcessedParametersVJgeneration_probability.pyGenerationProbabilityVDJ, GenerationProbabilityVJsequence_generation.pySequenceGenerationVDJ, SequenceGenerationVJutils.pyN/A (contains util functions)The classes with methods that are of interest will be GenerationProbabilityV(D)J (to compute Pgens) and SequenceGenerationV(D)J (to generate sequences).There is a fair amount of parameter processing that must go on to call these methods, however this is generally all done by instantiating a particular class. An exception to this rule are the classes GenerativeModelV(D)J and GenomicDataV(D)J. Normally the genomic data and model parameters are read in from IGoR inference files (and prepared V and J anchor files that have been prepared), however this is not mandated in order to make it easier for people to adapt the code to read in models/genomic data from other sources.Instantiating GenerativeModelV(D)J and GenomicDataV(D)J leaves the attributes as dummies, and calling the methods load_and_process_igor_model and load_igor_genomic_data will load up IGoR files.If you want to load models/data from other sources, you will need to write your own methods to set the attributes in GenerativeModelV(D)J and GenomicDataV(D)J. Please see the documentation of load_model.py for more details.Here is an example of loading the default human TRB model to compute some sequence Pgens and to generate some random CDR3 sequences:>> import olga.load_model as load_model>>> import olga.generation_probability as pgen>>> import olga.sequence_generation as seq_gen>>>>>> #Define the files for loading in generative model/data... params_file_name = 'default_models/human_T_beta/model_params.txt'>>> marginals_file_name = 'default_models/human_T_beta/model_marginals.txt'>>> V_anchor_pos_file ='default_models/human_T_beta/V_gene_CDR3_anchors.csv'>>> J_anchor_pos_file = 'default_models/human_T_beta/J_gene_CDR3_anchors.csv'>>>>>> #Load data... genomic_data = load_model.GenomicDataVDJ()>>> genomic_data.load_igor_genomic_data(params_file_name, V_anchor_pos_file, J_anchor_pos_file)>>> #Load model... generative_model = load_model.GenerativeModelVDJ()>>> generative_model.load_and_process_igor_model(marginals_file_name)>>>>>> #Process model/data for pgen computation by instantiating GenerationProbabilityVDJ... pgen_model = pgen.GenerationProbabilityVDJ(generative_model, genomic_data)>>>>>> #Compute some sequence pgens... pgen_model.compute_regex_CDR3_template_pgen('CASSAX{0,5}SARPEQFF')6.846877804096558e-10>>> pgen_model.compute_aa_CDR3_pgen('CAWSVAPDRGGYTF', 'TRBV30*01', 'TRBJ1-2*01')1.203646865765782e-10>>> pgen_model.compute_nt_CDR3_pgen('TGTGCCAGTAGTATAACAACCCAGGGCTTGTACGAGCAGTACTTC')3.9945642868171824e-14>>>>>>>>> #Process model/data for sequence generation by instantiating SequenceGenerationVDJ... seq_gen_model = seq_gen.SequenceGenerationVDJ(generative_model, genomic_data)>>>>>> #Generate some random sequences... seq_gen_model.gen_rnd_prod_CDR3()('TGTGCCAGCAGTGAAAAAAGGCAATGGGAAAGCGGGGAGCTGTTTTTT', 'CASSEKRQWESGELFF', 27, 8)>>> seq_gen_model.gen_rnd_prod_CDR3()('TGTGCCAGCAGTTTAGTGGGAAGGGCGGGGCCCTATGGCTACACCTTC', 'CASSLVGRAGPYGYTF', 14, 1)>>> seq_gen_model.gen_rnd_prod_CDR3()('TGTGCCAGCTGGACAGGGGGCAACTACGAGCAGTACTTC', 'CASWTGGNYEQYF', 55, 13)">>>> import olga.load_model as load_model>>> import olga.generation_probability as pgen>>> import olga.sequence_generation as seq_gen>>>>>> #Define the files for loading in generative model/data... params_file_name = 'default_models/human_T_beta/model_params.txt'>>> marginals_file_name = 'default_models/human_T_beta/model_marginals.txt'>>> V_anchor_pos_file ='default_models/human_T_beta/V_gene_CDR3_anchors.csv'>>> J_anchor_pos_file = 'default_models/human_T_beta/J_gene_CDR3_anchors.csv'>>>>>> #Load data... genomic_data = load_model.GenomicDataVDJ()>>> genomic_data.load_igor_genomic_data(params_file_name, V_anchor_pos_file, J_anchor_pos_file)>>> #Load model... generative_model = load_model.GenerativeModelVDJ()>>> generative_model.load_and_process_igor_model(marginals_file_name)>>>>>> #Process model/data for pgen computation by

GitHub - ps2homebrew/pgen: PGEN is an old Sega Genesis

To load at most M sequences so, if wanted, one could build a parallelized wrapper around this script (though it would be recommended to instead just import the modules and build from there).Example calls (assuming a file example_seqs.tsv with the line structurentseq aaseq V_mask J_mask):Read in the ntseqs and print the ntseq, aaseq = nt2aa(ntseq) and their pgens to stdout$ olga-compute_pgen -i example_seqs.tsv --humanTRBOnly read in the first 10 sequences$ olga-compute_pgen -i example_seqs.tsv --humanTRB -m 10Read in the ntseqs, write the ntseq, aaseq = nt2aa(ntseq), and their pgens to example_pgens.tsv$ olga-compute_pgen -i example_seqs.tsv --humanTRB -o example_pgens.tsvSpecify the V/J mask indices$ olga-compute_pgen -i example_seqs.tsv --humanTRB -o example_pgens.tsv --v_in 2 --j_in 3Read in the aaseq column instead of the ntseq column$ olga-compute_pgen -i example_seqs.tsv --humanTRB -o example_pgens.tsv --seq_in 1Selected OptionsDescription-h, --helpshow full Options list and exit-i PATH/TO/FILEread in CDR3 sequences (and optionally V/J masks) from PATH/TO/FILE-o PATH/TO/FILEwrite CDR3 sequences and pgens to PATH/TO/FILE--seq_in INDEXspecifies sequences to be read in are in column INDEX. Default is index 0 (the first column).--v_in INDEXspecifies V_masks are found in column INDEX in the input file. Default is no V mask.--j_in INDEXspecifies J_masks are found in column INDEX in the input file. Default is no J mask.--v_mask V_MASKspecify V usage to condition Pgen on for seqs read in as arguments.--j_mask J_MASKspecify J usage to condition Pgen on for seqs read in as arguments.-m Ncompute Pgens for at most N sequences.--lines_to_skip Nskip the first N lines of the file. Default is 0.-a PATH/TO/FILEspecify PATH/TO/FILE defining a custom 'amino acid' alphabet. Default is no custom alphabet.--seq_type_out SEQ_TYPEif read in sequences are ntseqs, declare what type of sequence to compute pgen for. Default is all. Choices: 'all', 'ntseq', 'aaseq'--display_offturn the sequence display off (only applies in write-to-file mode). Default is on.-d DELIMITERdeclare infile delimiter. Default is tab for .tsv input files, comma for .csv files, and any whitespace for all others. Choices: 'tab', 'space', ',', ';', ':'--raw_delimiter DELIMITERdeclare infile delimiter as a raw string.--delimiter_out, --raw_delimiter_out, --gene_mask_delimiter, --raw_gene_mask_delimiterdeclare delimiters for the outfile and for gene masks (read in from the columns of v_mask_index and j_mask_index). Same syntax as the infile delimiter.--comment_delimiter

ECS Protector Nitrogen Generator PGEN 30 (PGEN 30E)

Card SeriesPlayersTeam/PositionAll-Star 2023Bucks/PFAll-Star 2023Lakers/SFSeason 5 RewardsHeat/SGCollector RewardsRockets/CCollector RewardsSpurs/SGRadiantMagic/SFRadiantSpurs/CNew EditionHeat/SG16-BitHornets/PG16-BitWizards/CNew EditionKings/PGHighlight ReelLakers/SGHighlight ReelPelicans/PFNew EditionRaptors/PFBracket BustersBucks/CBracket BustersKings/PGBracket BustersTrail Blazers/CBracket BustersPistons/SFOut Of PositionBulls/PGOut Of PositionCeltics/SFNew EditionTrail Blazers/SGPhenomsMagic/CPhenomsLakers/PGNew EditionLakers/PFSeason 5 RewardsWizards/SFSeason 5 RewardsNuggets/CHigh-ResPistons/PGHigh-ResSuns/SGSeason 6 RewardsRockets/CSeason 6 RewardsPistons/PGSeason 6 RewardsClippers/SGSeason 6 RewardsHawks/SFSuper-SonicBulls/PGSuper-SonicSuperSonics/SFHeroThunder/SFSuper-SonicWarriors/CCollector RewardsCeltics/PFHeroicClippers/SGHeroThunder/SFElementalBulls/SGHeroBulls/SGElementalRockets/CElementalClippers/SFPlayoffsBucks/PFPlayoffsClippers/SFPlayoffsHeat/SFPlayoffsHeat/SGPlayoffsLakers/CPlayoffsLakers/SFPlayoffsSuns/SGPlayoffsSuns/PFPlayoffsCeltics/SFPlayoffsClippers/PGPlayoffsHeat/CPlayoffsKings/PGPlayoffsNuggets/CPlayoffsNuggets/PFPlayoffsWarriors/PGPlayoffsTimberwolves/SGPlayoffs76ers/PGPlayoffsHawks/PGPlayoffsNuggets/SFPlayoffsWarriors/PFPlayoffsCeltics/PGPlayoffsKings/SGPlayoffsKnicks/CPlayoffsNuggets/PGPlayoffsNuggets/SFPlayoffsBucks/CPlayoffsNuggets/SGPlayoffsWarriors/CPlayoffs76ers/SGPlayoffsCeltics/SGPlayoffsNuggets/CPlayoffsKnicks/PGPlayoffsGrizzlies/SGPlayoffsNuggets/PGPlayoffsHeat/PGPlayoffsHeat/PFPlayoffsNuggets/SGPlayoffsNuggets/CPlayoffsNuggets/SFPlayoffsNuggets/PGPlayoffsNuggets/PFHeroicMagic/PGHeroMagic/PGOut Of Position 2Nuggets/PGOut Of Position 2Pacers/PGOut Of Position 2Celtics/SGHeroNuggets/PGHeroic76ers/CHero76ers/CInterdimensionalMavericks/PGInterdimensionalNuggets/PFInterdimensionalKnicks/SFHeroMagic/PFHeroBucks/SFSeason 6 RewardsWizards/PGSeason 6 RewardsHeat/PFHeroicSpurs/SGHeroSpurs/SGTitansRockets/CTitansNets/PGTitansMavericks/PFHeroRockets/CHero76ers/PGHeroWizards/CHeroicSpurs/PFHeroicNuggets/SGHero Knicks/SGHeroThunder/PFSeason 6 RewardsHawks/PFInvincibleMagic/SGGenerationalRaptors/SFGenerationalThunder/PGGenerationalKnicks/CGenerationalRockets/SGAll-TimeBucks/CCard SeriesPlayersTeam/PositionAll-TimeBulls/SGAll-TimeCavaliers/SFAll-TimeHeat/SFInvinciblePelicans/PFSeason 7 RewardsCeltics/SFSeason 7 RewardsWarriors/SGSeason 7 RewardsBulls/CSeason 7 RewardsKnicks/SGSeason 7 RewardsKings/SGSeason 7 RewardsTrail Blazers/PGSeason 7 RewardsSpurs/SFSeason 7 RewardsPacers/CCollector RewardsCeltics/PFCollector RewardsBulls/PGInvincibleHawks/SGSeason 7 RewardsPacers/SGInvincibleBucks/PFInvincibleLakers/PGEn FuegoRockets/PGEn FuegoLakers/CEn FuegoMagic/SFEn FuegoHawks/SGEn FuegoKings/CRushSuns/PFRushWarriors/SGRushWizards/SGRushTrail Blazers/CRushJazz/SGInvincibleLakers/CInvincibleHornets/PGInvincibleBulls/SFSplash ZoneCeltics/SGSplash ZoneRaptors/PFSplash ZoneSuperSonics/SGSplash ZoneTrail Blazers/PGSplash ZoneSuperSonics/PFPioneers of the GameKnicks/PFPioneers of the GamePistons/SFPioneers of the GameCeltics/SFRushBucks/SFRushLakers/PFRushBulls/SFRushKings/CRushBucks/SGAll-Time RewardPelicans/SGInvincibleCavaliers/SFInvincibleLakers/PFInvincibleNuggets/SFInvincibleWarriors/PGHeatwaveWarriors/SGHeatwavePacers/SGHeatwaveCeltics/SFHeatwaveRockets/CHeatwaveSuns/SGHeatwavePacers/PGHeatwavePacers/PFHeatwavePelicans/PGHeatwave76ers/SGAll-Time RewardSuns/SGAll-Time RewardHornets/SFAll-Time RewardCeltics/PGAll-Time RewardMagic/CRushRaptors/SGRushGrizzlies/PGRushWarriors/SFRushKnicks/SFRushSuperSonics/PGAll-Time RewardBucks/PFAll-Time RewardThunder/CAll-Time Reward76ers/SFInvincibleLakers/SGInvincibleBulls/SGInvincibleBucks/CInvincibleCeltics/SFGloriousJazz/SFGloriousClippers/PFGloriousBucks/SFGloriousKnicks/PGGloriousRaptors/SFGloriousJazz/SFGloriousLakers/SFGloriousJazz/PGGloriousHawks/SFAll-Time RewardNets/PFSeason 7 RewardsBulls/PFSeason 7 RewardsMavericks/SFAll-Time RewardNuggets/SGAll-Time RewardMavericks/PGAll-Time RewardPistons/CRushWizards/PGRushJazz/SGRushNets/PGRushLakers/CRushWarriors/SGAll-Time RewardRaptors/PGAll-Time RewardPacers/PFAll-Time RewardHeat/PGEnd GameThunder/SFInvincibleThunder/PGInvincibleKnicks/CInvincibleCeltics/SFInvincibleSpurs/SFEncoreGrizzlies/SFEncoreJazz/CEncoreJazz/PFEncoreCavaliers/PGEncoreCeltics/PGEncoreTrail Blazers/PFEncoreRaptors/SFEncoreHawks/SGAll-Time RewardKnicks/SGAll-Time RewardWarriors/SFAll-Time RewardGrizzlies/PFAll-Time RewardWizards/PGRushTimberwolves/SGRushGrizzlies/PFRushWizards/PFRushLakers/SFCard SeriesPlayersTeam/PositionRushSuns/PGAll-Time RewardCavaliers/CAll-Time RewardBulls/SGEnd GameMagic/PFInvinciblePFInvinciblePistons/PGInvincibleCavaliers/PFInvincibleRockets/PFInvincibleThunder/SFInvincibleJazz/CNextPFNextSFNextSGNextSGNextSFNextSGNextSFNextSGNextPGNextSGSeason 7 Rewards76ers/SGAll-Time RewardSpurs/PGAll-Time RewardClippers/PFAll-Time RewardHawks/PFAll-Time RewardJazz/PGAll-Time RewardLakers/SFAll-Time RewardRockets/SFAll-Time RewardTimberwolves/PFAll-Time RewardKings/SGAll-Time RewardTrail Blazers/PFEnd Game76ers/CEnd Game76ers/SGInvincibleRaptors/CInvinciblePistons/SGInvincibleClippers/PFInvinciblePelicans/SFInvincibleWarriors/PGInvincibleNets/PFInvincibleSuperSonics/SGEnd GameSuperSonics/SFInvinciblePistons/CSeason 8 RewardsPistons/PGEnd GameWarriors/PGEnd GameMavericks/PGEnd GameSpurs/CEnd GamePacers/SGInvincibleSuns/SGInvinciblePacers/SFInvincibleTimberwolves/SGInvincibleKings/CSeason 8 Knicks/SFSeason 8 Cavaliers/PGSeason 8 Wizards/SFEnd GameCeltics/CEnd GameLakers/CEnd GameHeat/SGEnd GameHeat/SGInvincibleMagic/PGInvinciblePistons/SFEnd GameLakers/SGEnd GameCavaliers/SFEnd GameBulls/SGEnd GameSpurs/PFInvincibleBulls/PGInvincibleRaptors/PFInvincibleLakers/SFInvincibleSpurs/SGSeason 8 Cavaliers/PFSeason 8 Nets/PGEnd GameLakers/PGEnd GameBucks/CEnd GameCeltics/SFInvincibleGrizzlies/PGInvincibleSuperSonics/SGEnd GameBucks/SFEnd GameMagic/PFEnd GameMavericks/PFEnd GameNuggets/CInvincibleGrizzlies/PFInvincibleGrizzlies/CInvincibleNets/SGInvincibleJazz/SFSeason 8 Thunder/PGSeason 8 Thunder/SFEnd GameCeltics/SFEnd GameNuggets/SGEnd GameWarriors/CInvincibleWarriors/SGInvincibleClippers/PFEnd GameRockets/CEnd GameKnicks/PFEnd GameCeltics/CEnd GameSpurs/PFInvincibleBucks/SGInvincibleCavaliers/SGInvincibleLakers/SFInvincibleCavaliers/CSeason 8 Pacers/SFSeason 8 Warriors/PGEnd GameRaptors/SGEnd Game76ers/PFEnd GameTimberwolves/PFEnd Game76ers/PGEnd GameBulls/SFEnd GameRockets/CInvincibleMagic/CInvincibleTrail Blazers/SGEnd GameMagic/SGEnd GameSpurs/SGEnd GamePelicans/PFEnd GameTimberwolves/PFInvincibleJazz/CInvincibleHornets/SGInvincibleMagic/SFInvincibleWizards/CSeason 8 Wizards/CSeason 8 Knicks/SG Classic: Type in answers that appear in a list 25m, 353 Questions Last Updated: Jul 21, 2023 Quiz Scoreboard Recently Published More to Explore Quiz From the Vault Featured Blog Post You Might Also Like... Trending Topics. PGEN (Codejunkies version).7z download 1.3M PGEN (with updated USBD by ffgriever) v1.5.1.7z download