Promega biomath

Author: s | 2025-04-24

★★★★☆ (4.2 / 3042 reviews)

aml pages portable

Promega Biomath Calculators is free Tools app, developed by Promega Corporation. Latest version of Promega Biomath Calculators is 1.1.1, was released on (updated on ). Estimated number of the downloads is more than 5,000. Overall rating of Promega Biomath Calculators is 4,5. Download Promega Biomath Calculators latest version for Android free. Promega Biomath Calculators latest update: Decem

Download iron man 3 theme

Promega Biomath Calculators by Promega Corporation

Fragments by the sonicator. After centrifugation, the supernatants were taken and chromatin was incubated and precipitated with CTNNB1 antibodies (ab32572)(1:150, abcam,USA) or IgG (Beyotime Biotechnology, Shanghai, China) at 4°C overnight. The immune complexes were then precipitated using protein A/G-Sepharose beads (GE Healthcare, Chicago, USA) for 4 h. Next, the immune complexes were washed with different washing buffers, followed by a low-salt washing buffer, high-salt washing buffer, LiCl washing buffer, and TE buffer. The immune precipitates were eluted using elution buffer and reversal of crosslinking at 65°C overnight, and KCNQ1OT1 promoter primers (F: GTTTGAACACGGTCAGCACG; R:CAGCCCAC TCTGAACCACC) were used to amplify the binding sites for β-catenin. DNA was finally eluted as per the manufacturer’s protocol and analysed by qRT-PCR. Primers are summarized in Supplementary Materials and Methods.Dual luciferase reporter assayThe modified reporter vectors used in this assay were all constructed by GENERAL BIOL (China). Cells were seeded in 24-well plates and co-transfected with ACVRL1 3′-UTR reporter plasmids (wild-type or mutant) and miR-7-5p mimics. The KCNQ1OT1 promoter (Kp2022) and KCNQ1OT1-binding-mut promoter (Kp1080) in which the TCF-1-binding site was mutated were cloned into pGL3-Basic vector (Promega), and the TCF-1 overexpression and control CRC cells were transfected with the above modified vector. KCNQ1OT1 gene and KCNQ1OT1-mut sequence were cloned into pmirGLO vector (Promega). Renilla luciferase (pRL-TK) (Beyotime Biotechnology, China) was used as a transfection control. Luciferase activity was measured using the dual luciferase reporter assay system (Promega, USA). Relative promoter activity was calculated as firefly luminescence/Renilla luminescence.Animal experimentsSix-week-old female nude BALB/C mice (Vital River Laboratories, China) were subcutaneously injected with HCT15 cells transfected with shACVRL1 or shNTC Lentivirus. When tumour volumes reached approximately 0.2 cm3, the mice were treated with 30 mg/kg Regorafenib or Sorafenib daily (orally) for 3 weeks.B-NSG mice (Biocytogen, China) were used to establish patient-derived xenograft (PDX) models, as described in our Promega Biomath Calculators is free Tools app, developed by Promega Corporation. Latest version of Promega Biomath Calculators is 1.1.1, was released on (updated on ). Estimated number of the downloads is more than 5,000. Overall rating of Promega Biomath Calculators is 4,5. Download Promega Biomath Calculators latest version for Android free. Promega Biomath Calculators latest update: Decem Home Promega Products Capillary Electrophoresis (CE) Workflows STR Amplification Co-Amplification and Fluorescent Detection of 24 Loci Meets CODIS and European standards High inhibitor tolerance and sensitivity for casework One kit for both casework and database sections Size 200 reactions 800 reactions Catalog number selected: DC2402 PowerPlex® Fusion System 200 reactions Change Configuration Overview Protocols Specifications Resources Related Products Workflows More Information and Superior Performance from a Single Kit The PowerPlex® Fusion System provides all of the materials needed for co-amplification and fluorescent detection of 24 loci (23 STR loci and Amelogenin, but without SE33), including the CODIS core loci and European Standard Set (ESS) loci. This comprehensive set supports compatibility with present databases across multiple regions and encompasses an expanded set of loci to address future growth. The PowerPlex® Fusion System delivers more information and high success rates from demanding forensic, paternity and relationship-testing cases. Using proven STR chemistries for existing instrument platforms and software, this 5-color system requires no software or instrument upgrades. Promega forensic products are manufactured in alignment with the ISO 18385 standard. This standard ensures minimal risk of human DNA contamination for products used to collect, store and analyze biological materials for forensic purposes. Learn more. High Discriminatory Power PowerPlex® Fusion loci set is exceptional. By combining US CODIS and ESS loci, the system offers significant gains in discriminatory power and helps ensure fewer adventitious matches are obtained. A probability of identity value (PI) is defined as the probability that two individuals selected at random will have an identical genotype at the tested locus. STR Kit Number of Loci PI* (N = 1036) GlobalFiler™ STR Kit 23 1.63 × 10–27 Investigator® 24plex Kit 23 1.63 × 10–27 PowerPlex® Fusion System 24 1.38 × 10–28 PowerPlex® Fusion 6C System 27 9.09× 10–31 *Note: PI values do not

Comments

User6269

Fragments by the sonicator. After centrifugation, the supernatants were taken and chromatin was incubated and precipitated with CTNNB1 antibodies (ab32572)(1:150, abcam,USA) or IgG (Beyotime Biotechnology, Shanghai, China) at 4°C overnight. The immune complexes were then precipitated using protein A/G-Sepharose beads (GE Healthcare, Chicago, USA) for 4 h. Next, the immune complexes were washed with different washing buffers, followed by a low-salt washing buffer, high-salt washing buffer, LiCl washing buffer, and TE buffer. The immune precipitates were eluted using elution buffer and reversal of crosslinking at 65°C overnight, and KCNQ1OT1 promoter primers (F: GTTTGAACACGGTCAGCACG; R:CAGCCCAC TCTGAACCACC) were used to amplify the binding sites for β-catenin. DNA was finally eluted as per the manufacturer’s protocol and analysed by qRT-PCR. Primers are summarized in Supplementary Materials and Methods.Dual luciferase reporter assayThe modified reporter vectors used in this assay were all constructed by GENERAL BIOL (China). Cells were seeded in 24-well plates and co-transfected with ACVRL1 3′-UTR reporter plasmids (wild-type or mutant) and miR-7-5p mimics. The KCNQ1OT1 promoter (Kp2022) and KCNQ1OT1-binding-mut promoter (Kp1080) in which the TCF-1-binding site was mutated were cloned into pGL3-Basic vector (Promega), and the TCF-1 overexpression and control CRC cells were transfected with the above modified vector. KCNQ1OT1 gene and KCNQ1OT1-mut sequence were cloned into pmirGLO vector (Promega). Renilla luciferase (pRL-TK) (Beyotime Biotechnology, China) was used as a transfection control. Luciferase activity was measured using the dual luciferase reporter assay system (Promega, USA). Relative promoter activity was calculated as firefly luminescence/Renilla luminescence.Animal experimentsSix-week-old female nude BALB/C mice (Vital River Laboratories, China) were subcutaneously injected with HCT15 cells transfected with shACVRL1 or shNTC Lentivirus. When tumour volumes reached approximately 0.2 cm3, the mice were treated with 30 mg/kg Regorafenib or Sorafenib daily (orally) for 3 weeks.B-NSG mice (Biocytogen, China) were used to establish patient-derived xenograft (PDX) models, as described in our

2025-04-07
User4407

Home Promega Products Capillary Electrophoresis (CE) Workflows STR Amplification Co-Amplification and Fluorescent Detection of 24 Loci Meets CODIS and European standards High inhibitor tolerance and sensitivity for casework One kit for both casework and database sections Size 200 reactions 800 reactions Catalog number selected: DC2402 PowerPlex® Fusion System 200 reactions Change Configuration Overview Protocols Specifications Resources Related Products Workflows More Information and Superior Performance from a Single Kit The PowerPlex® Fusion System provides all of the materials needed for co-amplification and fluorescent detection of 24 loci (23 STR loci and Amelogenin, but without SE33), including the CODIS core loci and European Standard Set (ESS) loci. This comprehensive set supports compatibility with present databases across multiple regions and encompasses an expanded set of loci to address future growth. The PowerPlex® Fusion System delivers more information and high success rates from demanding forensic, paternity and relationship-testing cases. Using proven STR chemistries for existing instrument platforms and software, this 5-color system requires no software or instrument upgrades. Promega forensic products are manufactured in alignment with the ISO 18385 standard. This standard ensures minimal risk of human DNA contamination for products used to collect, store and analyze biological materials for forensic purposes. Learn more. High Discriminatory Power PowerPlex® Fusion loci set is exceptional. By combining US CODIS and ESS loci, the system offers significant gains in discriminatory power and helps ensure fewer adventitious matches are obtained. A probability of identity value (PI) is defined as the probability that two individuals selected at random will have an identical genotype at the tested locus. STR Kit Number of Loci PI* (N = 1036) GlobalFiler™ STR Kit 23 1.63 × 10–27 Investigator® 24plex Kit 23 1.63 × 10–27 PowerPlex® Fusion System 24 1.38 × 10–28 PowerPlex® Fusion 6C System 27 9.09× 10–31 *Note: PI values do not

2025-03-30
User4935

IPSWICH, MA (January 28, 2014) – NEBioCalculator, a new online “conversions and calculations” tool developed by New England Biolabs (NEB®), offers bench-side support for molecular biology experimental planning. Boasting improved algorithms and a more intuitive interface, NEBioCalculator supports several commonly-used biomath needs, such as molarity calculation, OD260 conversion, ligation calculation, and mass/moles conversion for both dsDNA and ssRNA. NEBioCalculator joins the growing selection of online tools and Apple® and Android™ apps from NEB, which include the popular NEB Tools, Double Digest Finder and Enzyme Finder, as well as NEBuilder®, NEBaseChanger™, and its Tm Calculator.Unlike other web-based conversion tools, NEBioCalculator provides calculations based on user-specified units, rather than a “one size fits all” single-unit model. Scientists can input their measurements in milligram, microgram, nanogram or picogram amounts, leading to accurate calculations that require no further conversion.“Our customers can educate themselves on an application, identify reagents needed, and design their experiments – all while visiting NEB’s website,” said Tanya Osterfield, Manager of Digital Marketing at NEB.“NEBioCalculator is a useful tool that will help improve our customers’ user experience, as we strive to provide unmatched scientific and technical support to our customers.”NEBioCalculator was developed as a part of NEB’s cloning educational campaign, which includes new animations about the various types of cloning workflows, and special rewards for purchasing NEB cloning products. For more information on this campaign, visit CloneWithNEB.com.NEBioCalculator is available online, at NEBioCalculator.neb.comAbout New England BiolabsEstablished in the mid 1970's, New England Biolabs, Inc. is the industry leader in the discovery and

2025-04-02

Add Comment